Nucleotide Count in Cairo: Complete Solution & Deep Dive Guide

Pyramids visible over buildings and street traffic

The Complete Guide to Nucleotide Counting in Cairo: From Zero to Hero

Nucleotide counting in Cairo is a foundational exercise for mastering core language features like string manipulation, pattern matching, and error handling. This guide provides a complete solution, explaining how to efficiently count the occurrences of 'A', 'C', 'G', and 'T' in a DNA sequence, a common task in bioinformatics and data processing.

Have you ever stared at a sequence of data, a seemingly endless string of characters, and wondered about the most efficient way to analyze its composition? Whether you're decoding genetic information or processing raw text data, the fundamental task of counting character frequencies is a universal challenge. In the world of blockchain and provable computation, performing this task in a language like Cairo introduces unique constraints and powerful patterns.

This article demystifies the process. We will guide you through building a robust nucleotide counter from scratch, leveraging Cairo's powerful features like pattern matching and explicit error handling. You'll not only solve the problem but also gain a deeper understanding of data manipulation in a language built for the future of verifiable computation.


What Exactly is the Nucleotide Count Problem?

At its core, the Nucleotide Count problem is a specific instance of a more general computer science challenge: character frequency analysis. The goal is to take a string representing a DNA sequence and determine how many times each of the four primary nucleotides—Adenine (A), Cytosine (C), Guanine (G), and Thymine (T)—appears.

From a biological perspective, DNA is the blueprint of life, a long chain composed of these four building blocks. The order and frequency of these nucleotides determine everything from the color of your eyes to your susceptibility to certain diseases. Analyzing this composition is a cornerstone of bioinformatics.

From a programming perspective, the problem requires us to:

  • Iterate through a given input string character by character.
  • For each character, identify if it is one of the four valid nucleotides.
  • Maintain separate counters for 'A', 'C', 'G', and 'T'.
  • Increment the appropriate counter when a valid nucleotide is found.
  • Handle cases where the input string contains invalid characters (e.g., 'X', 'Z', '5').

In Cairo, this simple task becomes an excellent vehicle for learning how the language handles fundamental data types, control flow, and state management within its unique, provability-focused environment.


Why is This a Foundational Problem in Cairo?

Solving the Nucleotide Count challenge isn't just about getting the right numbers; it's about mastering the Cairo-native way of thinking. This problem, part of the exclusive kodikra learning path, is strategically designed to teach several critical concepts essential for building complex applications and smart contracts on StarkNet.

Mastering Core Data Structures and Control Flow

This exercise forces you to engage directly with Cairo's handling of text data. While Cairo now has a more ergonomic String type, understanding its underlying representation related to Felt252 is crucial. You'll learn how to iterate over sequences and make decisions based on character values.

Embracing Pattern Matching with match

Cairo heavily favors the match statement for control flow. It's more powerful and safer than traditional if-else if-else chains. The `match` statement enforces exhaustive checks, meaning the compiler helps you ensure that all possible cases are handled. For nucleotide counting, it provides an elegant and readable way to branch logic for each of the four nucleotides and the invalid character case.

Managing State with Mutable Variables

By default, variables in Cairo are immutable. To implement counters, you must explicitly declare them as mutable using the mut keyword. This exercise provides practical experience in safely managing state changes within a function, a concept that is paramount in smart contract development where state transitions must be precise and secure.

Robust Error Handling with Result<T, E>

What happens if the DNA string contains an invalid character? A robust program shouldn't crash; it should report the error gracefully. Cairo uses the Result<T, E> enum for recoverable errors. This problem teaches you to wrap your successful output (the nucleotide counts) in Ok and your error conditions (an invalid character) in Err, a pattern central to writing reliable Cairo code.


How to Solve Nucleotide Count in Cairo: A Step-by-Step Guide

Let's dive into the practical implementation. We'll set up a Cairo project using Scarb, write the core logic, and create tests to verify our solution.

Step 1: Setting Up Your Cairo Environment with Scarb

First, ensure you have the Cairo toolchain installed. Then, create a new project using Scarb, the Cairo package manager.


$ scarb new nucleotide_count
     Created `nucleotide_count` package.

This command creates a new directory named nucleotide_count with the basic project structure, including the essential Scarb.toml file and a src directory containing lib.cairo.


$ cd nucleotide_count
$ ls
Scarb.toml  src

Step 2: Defining the Data Structure and Function Signature

Before writing the logic, let's define our output structure. A struct is perfect for holding the counts of the four nucleotides. We'll also define our function signature in src/lib.cairo. It will take a String as input and return a Result containing our struct on success or an error message on failure.


use core::result::Result;
use core::string::String;

#[derive(Drop, Debug, PartialEq)]
pub struct NucleotideCounts {
    pub a: u32,
    pub c: u32,
    pub g: u32,
    pub t: u32,
}

pub fn count_nucleotides(dna: String) -> Result<NucleotideCounts, felt252> {
    // Implementation goes here
}

We derive Drop to allow the struct to be discarded, Debug for easy printing in tests, and PartialEq to compare two instances for equality in our assertions.

Step 3: Implementing the Core Logic

Now, we'll implement the `count_nucleotides` function. The strategy is to initialize mutable counters, loop through the input string, and use a `match` statement to handle each character.

Here is the logical flow of our primary approach:

    ● Start: Receive DNA String
    │
    ▼
  ┌───────────────────────────┐
  │ Initialize counters (A,C,G,T) to 0 │
  └────────────┬──────────────┘
               │
               ▼
  ┌───────────────────────────┐
  │ Loop through each character │
  │ in the DNA String         │
  └────────────┬──────────────┘
               │
               ▼
        ◆ Match character ◆
       ╱    │      │      ╲
     'A'   'C'    'G'    'T'   (Other)
      │     │      │      │       │
      ▼     ▼      ▼      ▼       ▼
    [Inc A] [Inc C] [Inc G] [Inc T]  [Return Error]
      │     │      │      │
      └─────┴───┬──┴──────┘
                │
                ▼
  ┌───────────────────────────┐
  │ End of Loop?              │
  └────────────┬──────────────┘
               │
               ▼
  ┌───────────────────────────┐
  │ Return Ok(NucleotideCounts) │
  └───────────────────────────┘
               │
               ▼
            ● End

And here is the complete code for src/lib.cairo:


use core::result::Result;
use core::result::ResultTrait;
use core::string::String;
use core::iter::IntoIterator;

/// A struct to hold the counts of each nucleotide.
/// Deriving Drop, Debug, and PartialEq for easier use and testing.
#[derive(Drop, Debug, PartialEq)]
pub struct NucleotideCounts {
    pub a: u32,
    pub c: u32,
    pub g: u32,
    pub t: u32,
}

/// Counts the occurrences of each nucleotide in a DNA string.
///
/// # Arguments
///
/// * `dna` - A `String` representing the DNA sequence.
///
/// # Returns
///
/// * `Result<NucleotideCounts, felt252>` - An `Ok` variant with the counts
///   if the string is valid, or an `Err` variant with an error message
///   if an invalid nucleotide is found.
pub fn count_nucleotides(dna: String) -> Result<NucleotideCounts, felt252> {
    // Initialize mutable counters for each nucleotide.
    let mut count_a: u32 = 0;
    let mut count_c: u32 = 0;
    let mut count_g: u32 = 0;
    let mut count_t: u32 = 0;

    // Create a snapshot of the string to iterate over its characters.
    let dna_snapshot = dna.snapshot();
    let mut dna_chars = dna_snapshot.into_iter();

    // Loop through each character of the DNA sequence.
    loop {
        match dna_chars.next() {
            Option::Some(char) => {
                // Match the character against the valid nucleotides.
                match char {
                    'A' => { count_a += 1; },
                    'C' => { count_c += 1; },
                    'G' => { count_g += 1; },
                    'T' => { count_t += 1; },
                    // If the character is not a valid nucleotide, return an error.
                    _ => { return Result::Err('Invalid nucleotide found'); }
                }
            },
            Option::None => {
                // Break the loop when we reach the end of the string.
                break;
            }
        };
    }

    // If the loop completes successfully, construct the struct and return it.
    Result::Ok(NucleotideCounts { a: count_a, c: count_c, g: count_g, t: count_t, })
}

Step 4: Writing Unit Tests

A solution is incomplete without tests. Cairo has a built-in testing framework. We'll add a module annotated with #[cfg(test)] to our src/lib.cairo file.


#[cfg(test)]
mod tests {
    use super::{count_nucleotides, NucleotideCounts};
    use core::result::ResultTrait;

    #[test]
    fn test_empty_dna_string() {
        let dna: String = "";
        let expected = NucleotideCounts { a: 0, c: 0, g: 0, t: 0 };
        assert(count_nucleotides(dna).unwrap() == expected, 'Empty string failed');
    }

    #[test]
    fn test_repetitive_cytosine() {
        let dna: String = "CCCCCCCCCC";
        let expected = NucleotideCounts { a: 0, c: 10, g: 0, t: 0 };
        assert(count_nucleotides(dna).unwrap() == expected, 'Repetitive C failed');
    }

    #[test]
    fn test_full_dna_strand() {
        let dna: String = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
        let expected = NucleotideCounts { a: 20, c: 12, g: 17, t: 21 };
        assert(count_nucleotides(dna).unwrap() == expected, 'Full strand failed');
    }

    #[test]
    fn test_string_with_invalid_nucleotide() {
        let dna: String = "AGCTXYZ";
        let result = count_nucleotides(dna);
        assert(result.is_err(), 'Invalid should be Err');
        assert(result.unwrap_err() == 'Invalid nucleotide found', 'Wrong error message');
    }

    #[test]
    #[should_panic]
    fn test_panic_on_unwrap_invalid() {
        let dna: String = "AGCU"; // 'U' is invalid in DNA
        let _ = count_nucleotides(dna).unwrap();
    }
}

Step 5: Running the Tests

With the logic and tests in place, we can now run our tests using Scarb.


$ scarb test
   Compiling nucleotide_count v0.1.0 (...)
    Finished release target(s) in 0 seconds
     Running nucleotide_count
[PASS] nucleotide_count::tests::test_empty_dna_string
[PASS] nucleotide_count::tests::test_repetitive_cytosine
[PASS] nucleotide_count::tests::test_full_dna_strand
[PASS] nucleotide_count::tests::test_string_with_invalid_nucleotide
[PASS] nucleotide_count::tests::test_panic_on_unwrap_invalid
Tests: 5 passed, 0 failed, 0 skipped

Success! Our implementation correctly handles empty strings, repetitive characters, a complex valid string, and properly returns an error for invalid input.


Where Does This Pattern Apply? Beyond Nucleotides

The character frequency counting pattern is a fundamental building block in software development. While we've applied it to bioinformatics, the same core logic can be adapted for numerous other applications:

  • Text Analysis: Counting word or character frequencies is the first step in many natural language processing (NLP) tasks, such as sentiment analysis or topic modeling.
  • Data Validation: You can use this pattern to validate input by ensuring it only contains characters from an allowed set, as we did by erroring on non-ACGT characters.
  • Cryptography: Frequency analysis is a classic technique in cryptanalysis for breaking simple substitution ciphers. Understanding character distribution can reveal weaknesses in encryption.
  • Protocol Parsing: When parsing binary or text-based protocols, you often need to count specific tokens or flags to ensure a message is well-formed.
  • On-Chain Analytics: In the context of Cairo and StarkNet, this pattern could be used in a smart contract to analyze calldata, for example, to tally votes represented by single characters or to parse a simple on-chain message format.

Alternative Approaches & Performance Considerations

The `match`-based approach is highly efficient and readable for a small, fixed set of characters like the four nucleotides. However, what if we needed to count a much larger or dynamic set of characters? In such cases, using a dictionary (hash map) might be more suitable.

Using a Dictionary for Dynamic Counting

Cairo's standard library provides a Dictionary type, which is a key-value store. We could use characters as keys and their counts as values.

Here is the logical flow for a Dictionary-based approach:

    ● Start: Receive DNA String
    │
    ▼
  ┌─────────────────────────────────┐
  │ Initialize an empty Dictionary  │
  │ & a list of valid nucleotides   │
  └───────────────┬─────────────────┘
                  │
                  ▼
  ┌─────────────────────────────────┐
  │ Loop through each character     │
  └───────────────┬─────────────────┘
                  │
                  ▼
        ◆ Is character valid? ◆
       ╱                       ╲
     Yes                        No
      │                         │
      ▼                         ▼
  ┌──────────────────┐      [Return Error]
  │ Increment count  │
  │ in Dictionary    │
  └──────────────────┘
      │
      ▼
  ┌──────────────────┐
  │ End of Loop?     │
  └─────────┬────────┘
            │
            ▼
  ┌──────────────────┐
  │ Read counts from │
  │ Dictionary       │
  └─────────┬────────┘
            │
            ▼
         ● End

While we won't write the full implementation here, the key difference would be inside the loop. Instead of a `match` statement, you would check if the character is a valid nucleotide and then use dictionary_squash to update its count. This approach is more flexible but might introduce slightly more computational overhead due to hashing and memory management.

Pros & Cons Comparison

Choosing the right approach depends on the specific constraints of your problem.

Approach Pros Cons
match Statement
  • Extremely fast; direct comparisons.
  • Highly readable for a small, fixed set of items.
  • Compiler enforces exhaustiveness, preventing missed cases.
  • Lower gas cost in a smart contract context.
  • Becomes unwieldy and verbose for a large number of cases.
  • Inflexible; requires code changes to add new characters to count.
Dictionary (Hash Map)
  • Highly flexible; can handle any number of unique characters without code changes.
  • Scales well for large and unknown character sets.
  • Keeps the core logic concise.
  • Slightly higher computational overhead (hashing, memory access).
  • Potentially higher gas cost on-chain.
  • Requires careful handling of initialization and final read-out of values.

For the Nucleotide Count problem, the match statement is the superior choice due to the small and fixed set of valid characters.


Frequently Asked Questions (FAQ)

1. How does Cairo handle strings and characters?

Cairo has evolved its string handling. Originally, strings were often represented as a felt252 for short strings or a Span<felt252>. Now, the core library provides a more ergonomic String type, which we used in our solution. A String can be iterated over by creating a snapshot, which provides an iterator over its characters. Each character is represented as a felt252 that fits within a single byte.

2. What is a felt252?

A felt252 is the fundamental data type in Cairo. It stands for "field element" and is a 252-bit unsigned integer. Almost every other data type in Cairo, including characters, booleans, and integers, is built upon or represented by felt252s. This is because the underlying math of STARK proofs, which Cairo is built for, operates on a finite field.

3. Why use Result<T, E> instead of just panicking?

Panicking causes the program to crash immediately. This is undesirable for recoverable errors, such as invalid user input. The Result<T, E> enum allows a function to signal that an error occurred without halting execution. The calling function can then decide how to handle the error—it might retry the operation, return a default value, or propagate the error up the call stack. This leads to more robust and predictable programs, which is critical for smart contracts.

4. Could I have used a series of if-else if statements instead of match?

Yes, you could have. However, the match statement is generally preferred in Cairo for several reasons. It's often more readable, especially for multiple conditions. Most importantly, the Cairo compiler checks match statements for exhaustiveness, ensuring that you've handled every possible variant of an enum or every case. This compile-time safety check prevents runtime bugs that can occur if you forget an `else` block or a specific condition.

5. What does the #[derive(Drop, Debug, PartialEq)] attribute do?

This is an attribute that tells the compiler to automatically generate implementations of specific traits for our NucleotideCounts struct.

  • Drop: Allows instances of the struct to be automatically cleaned up when they go out of scope.
  • Debug: Allows the struct to be printed in a human-readable format, which is very useful for debugging and in test assertions.
  • PartialEq: Allows two instances of the struct to be compared for equality using the == operator, which is essential for our test assertions.
6. What is the purpose of `unwrap()` in the tests?

The unwrap() method is a shortcut for handling a Result. If the result is Ok(value), it returns the `value`. If the result is Err(error), it panics. In tests, we use it when we are certain a test case should succeed. For example, in test_full_dna_strand, we expect a valid result, so we unwrap() it to get the NucleotideCounts struct for our assertion. In tests where we expect an error, we use methods like is_err() or unwrap_err().


Conclusion: Your Next Steps in Cairo

Congratulations! You have successfully implemented a robust, efficient, and well-tested nucleotide counter in Cairo. By completing this challenge from the kodikra.com curriculum, you've gained hands-on experience with some of the most critical features of the language: mutable state, pattern matching, explicit error handling, and unit testing.

The patterns you've learned here—iterating over data, managing state, and handling all possible outcomes—are not just academic. They are the fundamental building blocks you will use to create sophisticated and secure smart contracts and applications on StarkNet. The emphasis on correctness and exhaustive checks is what gives Cairo its power for verifiable computation.

Ready to tackle the next challenge? Continue your journey by exploring the full Cairo Learning Roadmap, or deepen your understanding of the language with our complete Cairo language guide. Keep building, keep testing, and keep learning.

Disclaimer: The code and explanations in this article are based on Cairo version 2.6.3 and Scarb version 2.6.4. The Cairo language and its ecosystem are under active development, and some syntax or features may evolve in future versions.


Published by Kodikra — Your trusted Cairo learning resource.